Stajich seminar today on fungal population genomics

Genetics Seminar

“Population genomics of Batrachochytrium dendrobatidis, a fungal pathogen of amphibians”

Speaker: Dr. Jason Stajich

University of California, Riverside | Department Plant Pathology and Microbiology

Monday, April 23, 2012

4:10 PM

1022 Life Sciences

Best #openaccess figures: happy baby, sad baby

From J. Integrated Omics. DOI: 10.5584/jiomics.v2012i2012.76

One of the greatest things about open access papers in my mind is the ability to use the figures for blogs, classes, etc, without having to consult lawyers and other paper pushers. So I am starting a new series here where I highlight some fun/good figures from various open access papers.

The one shown above is from “How has the recent high-throughput sequencing revolution improved our knowledge of infant microbial colonization and health. J. Integrated Omics. DOI: 10.5584/jiomics.v2012i2012.76. By Adrien Fischer, Katrine Whiteson, Vladimir Lazarevic, Jonathan Hibbs, Patrice Francois, Jacques Schrenzel

BGI@UC Davis: Researcher Information Seminars May 2 and May 3

***Informational Seminar***

BGI@UC Davis – Information on partnership capabilities and sample submission

Presented by: Bart Weimer, Ph.D.

Professor, Department of Population Health and Reproduction, School of Veterinary Medicine

Co-director of BGI@UCDavis

Dates/Locations: Wednesday, May 2

Davis: Genome Center, Auditorium, Rm. 1005

3:00-3:45 pm

Thursday, May 3

Sacramento: Education Building, Lecture Hall 2222

4:00-4:45 pm

Abstract: Dr. Weimer will be presenting an information seminar to all interested researchers regarding the BGI@UC Davis partnership. Through BGI, campus researchers will have access to the capabilities and expertise of one of the world’s premier genomics and bioinformatics institutes, while BGI researchers will have the ability to collaborate with UC Davis researchers, thereby benefiting from the university’s diverse resources and expertise, especially in biology, medical sciences, agriculture, the environment and education. There will be two seminars available, one in Sacramento and one in Davis – everyone is welcome.

Ilkka Hanski seminars 4/25 & 4/26 at #UCDavis: Environmental biodiversity, human microbiota and allergy

Public Lecture:

Title: “Environmental biodiversity, human microbiota and allergy”
Time: Wednesday, April 25, 4:10 to 5:30 pm

Place: 1005 Genome

Evolution & Ecology Seminar:

Title: “Eco-evolutionary spatial dynamics”
Time: Thursday, April 26, 4:10 to 5:30 pm

Place: 1003 Giedt

Background:

Professor Hanski was awarded the Crafoord Prize in Biosciences by Royal Swedish Academy of Sciences in 2011 “for his pioneering studies on how spatial variation affects the dynamics of animal and plant populations”. He has established himself, in his more than 30-year career, as one of the world´s most eminent ecologists for developing a range of new analytical methods and mathematical models in ecology. Today, these are widely used to help scientists investigate how animal and plant species are affected when their habitats undergo splitting owing, for example, to urbanization, deforestation and climate change. Further, Hanski is recognized as a tireless advocate of the translational application of his research to public issues involving nature and biodiversity through his popular writings and public speaking. Among his many other honors, he is an elected Fellow of the Finnish Academy of Science and Letters, and a Foreign Member of the Royal Society (UK), the American Academy of Arts and Sciences and the National Academy of Sciences (US).

EVE 198 – Genome assembly

Well, doing some sequencing and genome assembly and analysis for my EVE 198 class and thought I would post notes here.

Step 1. Make Illumina libraries and generate sequence data.  Ideally PE but not 100% necessary

Step 2. Process data.

Raw data is here

Some test data for blast and trees

 

Step 3. Make 1st pass assembly using A5

Download an install

Running A5 on test data

Ran on Ruthia data

Step 4 View Results

Step 5 Gene finding

  • PhiX test
  • Practice on the web: Use NCBI ORF Finder
  • Phix Scaffold (test.final.scaffolds.fasta)
  • >scaffold1.1|size5470
    CGATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGACCAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTGCTATTCAGCGTTTGATGAATGCAATGCGACAGGCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGCCGTCTTCATTTCCATGCGGTGCACTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTAGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCATCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCATGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTGGATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCTCGTACGCCGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGC
  • Find ORFs at NCBI
  • http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi
  • Also uploaded to RAST http://rast.nmpdr.org/rast.cgi
  • Job finished http://rast.nmpdr.org/?page=JobDetails&job=48263

EVE Faculty Recruitment Seminar – Luke Harmon – Thursday, April 19th

DEPARTMENT OF EVOLUTION AND ECOLOGY

RECRUITMENT SEMINAR

EVOLUTION OF ORGANISMAL DIVERSITY

Luke Harmon

Assistant Professor

Department of Biological Sciences

University of Idaho

“Detecting the signature of species interactions in the tree of life”

Thursday, April 19th, 2012

1:10pm

1022 Life Sciences Building

Faculty Host: Professor Michael Turelli, Department of Evolution and Ecology

Harmon Seminar Flyer.doc

Davis Community Church Nursery School (DCCNS) Annual Rummage Sale 4/28 8 AM – noon

One giant tweet for @MishaAngrist talk at #UCDavis from 3/8

When Misha Angrist visited in March I took notes for his talk on … paper … because my phone was dead … so here is one big tweet for his talk. https://picasaweb.google.com/s/c/bin/slideshow.swf

Sept. 16-20, Lake Arrowhead Microbial Genomics Conference

This is the first announcement for the 2012 Microbial Genomics Conference, which will take place at the UCLA Conference Center, Lake Arrowhead, California, September 16-20, 2012.

Ashlee Earl, Jonathan Eisen, Elisabeth Raleigh and myself, this years co-organizers, have put together a partial program (see attached) for the 2012 Arrowhead Microbial Genomics meeting, which is part of a continuing series of interdisciplinary meetings centered on microbial genomics. The following link to the last meeting’s program gives information about the conference site and history: http://www.mimg.ucla.edu/arrowhead2010/ We hope to have the website for the new meeting up soon. This year’s registration fee for registering participants (excluding invited speakers) is $900, which covers all meals, lodging, and a chartered bus to and from LAX to the meeting site. The information on the website for the previous meeting is still valid for how to pay the registration fees, except that the amount is different from this year’s amount, due to increases in Arrowhead’s room rates.

I think this year’s meeting will be very exciting, and the preliminary program of invited speakers lists 30 of the total of 40 speakers. All but 2 (in asterisks) have accepted so far.

This conference is part of a yearly meeting initiated in 1991 to bring together genome sequencers, bioinformatics specialists, and biologists and geneticists, to forge interactions that would result in meaningful functional genomics. The goal of the meeting is to translate the influx of new genome sequencing information into useful biological studies. The Lake Arrowhead 2012 meeting will have a major focus on genomic and other studies of microbial communities and biodiversity, and in particular the human microbiome, comparative and functional genomics of pathogens, modeling and designing of circuits and pathways and bioenergetics.

Sincerely yours,

Jeffrey H. Miller

Arrowhead2012draft1A.doc

Canadian Society of Microbiologists 62nd Annual Conference June 20-23

The Canadian Society of Microbiologists cordially invites you to the 62nd Annual Conference, to beheld June 20-23 in Vancouver, British Columbia. This year’s meeting features plenary speakers Jonathan Eisen (UC Davis), Jeffrey F. Miller (UCLA), and David Relman (Stanford), and includes scientific sessions on host-pathogen interactions, microbial biotechnology, the human microbiome, horizontal gene transfer and population genetics, antibiotic discovery and resistance, and envirogenomics. CSM is an especially unique and affordable conference for students and trainees, with registration starting at only $125 for undergrads, awards for student presentations, and an unparalleled opportunity to network with international speakers in an intimate venue.

Abstract submission is open until April 25, and early registration rates – starting at only $125 – are available until May 18. For more information, see the attached poster or visit www.csm2012.ca.

We look forward to seeing you in Vancouver!

The CSM 2012 Local Organizing Committee

CSM_Mailer.pdf